non targeting shnt  (Addgene inc)

Journal: Stem Cell Research & Therapy

Article Title: Dextran sulfate prevents excess aggregation of human pluripotent stem cells in 3D culture by inhibiting ICAM1 expression coupled with down-regulating E-cadherin through activating the Wnt signaling pathway

doi: 10.1186/s13287-022-02890-4

Figure Lengend Snippet: Interfering ICAM1 endogenously by lentivirus-mediated shRNA. A The EGFP + colonies after lentivirus transduction and puromycin selection. Representative images were shown. Scale bar = 200 μm. B Gene expression analysis by qRT-PCR for ICAM1 in the H9 cells transduced with the lentivirus expressing different shRNAs, relative gene expression represents data normalized to GADPH and expressed relative to cells transduced with the lentivirus expressing shNT. C The EGFP + aggregates were shown in suspension culture on day 5. Representative images were shown. Scale bar = 200 μm. D Comparison of average diameter of the aggregates of the H9 cells in two groups. E Gene expression analysis by qRT-PCR for ICAM1 and OCT4 in the aggregates transduced with the lentivirus expressing shRNA-b and shNT, respectively, relative gene expression represents data normalized to GADPH and expressed relative to cells transfected by shNT. (F) The protein levels of E-cad and ICAM1 were determined by western blotting in the aggregates transduced with the lentivirus expressing shRNA-b and shNT, respectively, in two groups. G The densitometry for the protein levels of ICAM1 was quantitated in F; GAPDH was used as a loading control. Data represent the mean ± SD. * P < 0.05 and ** P < 0.01

Article Snippet: The doxycycline (Dox)-inducible short hairpin RNA (shRNA) targeting the human intercellular adhesion molecule 1 (ICAM1) gene and non-targeting scrambled shRNA (shNT), conjugated with GFP cloned in a lentivirus vector, were purchased from GeneCopoeia.

Techniques: shRNA, Transduction, Selection, Expressing, Quantitative RT-PCR, Transfection, Western Blot

Journal: Biology Open

Article Title: GRASP55 restricts early-stage autophagy and regulates spatial organization of the early secretory network

doi: 10.1242/bio.058736

Figure Lengend Snippet: Effect of GRASP55 depletion on autophagy. (A) GRASP55 knockdown (shG55 #06 or #63) or non-targeting control (shNT) cells were incubated in EBSS for 60 min with 100 nM bafilomycin A1 (BafA1) or left untreated (UT). Cells were immunostained for LC3B and DAPI-counterstained. Representative images are shown. Scale bar: 10 μm. (B) LC3B puncta were enumerated and normalized to the number of DAPI-stained nuclei on a per-image basis. Welch's ANOVA with Games-Howell's multiple comparisons test was performed within each treatment group, and multiplicity adjusted P -values are shown. n =90 images per group pooled from three replicates. Error bars: mean±95% confidence interval. (C) GRASP55 knockout (G55 KO) and control cells stably expressing mCherry-EGFP-LC3B were incubated in glucose-free media for 4 h. Live cells were imaged. Representative images are shown. Scale bar: 10 μm. (D) Double-positive (mCherry + EGFP + ), single-positive (mCherry + EGFP − ), and total (mCherry + EGFP + +mCherry + EGFP − ) LC3B puncta were counted and normalized to the number of nuclei on a per-image basis. A two-tailed unpaired Welch's t -test was performed for each group, and P -values are shown. n =77 images per cell line pooled from three replicates. Error bars: mean±95% confidence interval. (E) The ratio of mCherry + EGFP + puncta to total puncta on a per-image basis was calculated and reported as a percentage. A two-tailed unpaired Welch's t -test was performed, and the P -value is shown. n =77 images per cell line pooled from three replicates. Error bars: mean±95% confidence interval. (F) GRASP55 knockdown and control cells were incubated in EBSS for 60 min with 100 nM BafA1 or left untreated. Lysates were analyzed by anti-LC3 immunoblotting. A representative immunoblot is shown. (G) Densitometry of immunoblots from Fig. 1F . LC3-II/GAPDH ratios were calculated, normalizing to shNT controls within each treatment group. One-sample two-tailed t -tests were performed with a test value of 1, and P -values are shown. n =4 bioreplicates. Error bars: mean±s.d.

Article Snippet: Human Sec23IP cDNA construct (SC126781) and PCMV6-XL5 empty vector control (PCMV6XL5) were obtained from OriGene. pLKO.1 lentiviral expression vectors containing GRASP55 short hairpin RNA (shRNA) inserts were obtained from Sigma-Aldrich as follows: non-targeting control (shNT) (Sigma-Aldrich, SHC002); shGRASP55 #06 (shG55 #06) (Sigma-Aldrich, TRCN0000278406, sequence: ccgggacctcagtcacaccaagtaactcgagttacttggtgtgactgaggtctttttg); and shGRASP55 #63 (shG55 #63) (Sigma-Aldrich, TRCN0000278363, sequence: ccgggatctgctgaaagcaaacgttctcgagaacgtttgctttcagcagatctttttg).

Techniques: Incubation, Staining, Knock-Out, Stable Transfection, Expressing, Two Tailed Test, Western Blot

Journal: Biology Open

Article Title: GRASP55 restricts early-stage autophagy and regulates spatial organization of the early secretory network

doi: 10.1242/bio.058736

Figure Lengend Snippet: Effect of GRASP55 depletion on the ER-Golgi interface. (A) GRASP55 stable knockdown (shG55 #06 and #63) and non-targeting control (shNT) cells were stained for GM130 and Sec24B along with DAPI. Representative images are shown. Scale bar: 10 μm. (B) The areas covered by GM130 and Sec24B, including overlapping regions, were measured using ImageJ software. The ratio of overlapping region to individual area of a structure was calculated and reported as a percent. Welch's ANOVA with Games-Howell's multiple comparisons test was performed for each colocalization group, and multiplicity adjusted P -values are shown. n =150 cells pooled from three replicates. Error bars: mean±95% confidence interval.

Article Snippet: Human Sec23IP cDNA construct (SC126781) and PCMV6-XL5 empty vector control (PCMV6XL5) were obtained from OriGene. pLKO.1 lentiviral expression vectors containing GRASP55 short hairpin RNA (shRNA) inserts were obtained from Sigma-Aldrich as follows: non-targeting control (shNT) (Sigma-Aldrich, SHC002); shGRASP55 #06 (shG55 #06) (Sigma-Aldrich, TRCN0000278406, sequence: ccgggacctcagtcacaccaagtaactcgagttacttggtgtgactgaggtctttttg); and shGRASP55 #63 (shG55 #63) (Sigma-Aldrich, TRCN0000278363, sequence: ccgggatctgctgaaagcaaacgttctcgagaacgtttgctttcagcagatctttttg).

Techniques: Staining, Software

Journal: Life Science Alliance

Article Title: Elevated glucose increases genomic instability by inhibiting nucleotide excision repair

doi: 10.26508/lsa.202101159

Figure Lengend Snippet: (A) 293T cells were transduced with lentivirus containing non-targeting shRNA (shNT) or HIF1A-targeted shRNA (shHIF1A). HIF1A and nucleotide excision repair genes were analyzed by qRT-PCR (n = 3; two-way ANOVA with Sidak’s multiple comparisons). (B, C) 293T shNT and shHIF1A cells were treated with CoCl 2 and (B) HIF-1α protein was measured by Western blot and (C) HIF-1 transcriptional activity was measured by the HRE luciferase assay. ns, not significant, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: Non-target shRNA (shNT; SHC016; Sigma-Aldrich) and shHIF1A plasmids (SHCLNG-NM_001530 TRCN 0000003808; Sigma-Aldrich) were isolated from DH5α cells.

Techniques: Transduction, shRNA, Quantitative RT-PCR, Western Blot, Activity Assay, Luciferase